COVID-Challenge/main.cpp

#include <bits/stdc++.h>
using namespace std;
using ll = long long;

string P[3] = {
    "ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCA",
    "TTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTC",
    "TCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCT" };
double score[3][7] = {{449.7,449.7,449.7,449.7,437.7,161,147.35},
{450,435,450,449.7,444,180,139.8},
{449.4,449.1,404.7,450,449.7,147,148}
};

vector<string> vrt[7];

ll levenshtein(string &s, string &t){
  int n = s.size(), m = t.size();
  ll dp[n + 1][m + 1]; //goal to be low as possible
  for(int i = 0; i <= n; i++)
  for(int j = 0; j <= m; j++){
    ll &dpc = dp[i][j] = (i || j) * n * m;
    if(i) dpc = min(dpc, dp[i - 1][j] + 1); //add char s
    if(j) dpc = min(dpc, dp[i][j - 1] + 1); //add char t
    if(i && j) dpc = min(dpc, dp[i - 1][j - 1] + (s[i - 1] != t[j - 1])); //replace or equal
  }
  return dp[n][m];
}

ll smithWaterman(string &s, string &t){
  int n = s.size(), m = t.size(), x = 0, y = 0;
  ll dp[n + 1][m + 1]; //goal to be high as possible
  for(int i = 0; i <= n; i++) 
  for(int j = 0; j <= m; j++){
    ll &dpc = dp[i][j] = 0;
    if(i) dpc = max(dpc, dp[i - 1][j] - 2); //add char s
    if(j) dpc = max(dpc, dp[i][j - 1] - 2); //add char t
    if(i && j) dpc = max(dpc, dp[i - 1][j - 1] + 3 * (2 * (s[i - 1] == t[j - 1]) - 1)); //test equality
    if(dpc > dp[x][y]) x = i, y = j;
  } 
  return dp[x][y];
}

//change return to switch out objective
ll sequenceCmp(string s, string t){
  return smithWaterman(s, t);
}

const int k = 21;
bitset<k> test(string & probe) {
	bitset<k> bs;
	double avg[7];
	for (int i = 0; i < 7; ++i) {
        avg[i] = 0;
		for (int j = 0; j < 20; ++j) {
			avg[i] += sequenceCmp(probe, vrt[i][j]);
		}
		avg[i] /= 20;
        cout << avg[i] << ' ';
	}
	cout << '\n';
	int cnt = 0;
	for (int i = 0; i < 7; ++i) {
        for (int j = i+1; j < 7; ++j) {
            if (abs(avg[i]-avg[j]) > 10) bs[cnt] = 1;
			cnt++;
            cout << avg[i] << ' ' << avg[j] << ' ' << bs[cnt-1] << '\n';
        }
    }
    cout << bs << '\n';
	return bs;
}

vector<string> dp[4][1 << k];
void analyze_spike_sequences(){
	int cnt = 0;
  for (int i = 0; i < 7; ++i) {
		for (int j = 0; j <= vrt[i][0].size()-150; ++j) {
			string probe(begin(vrt[i][0])+j, begin(vrt[i][0])+j+150);
			bitset<k> bs = test(probe);
            cout << probe << ' ' << cnt++ << endl;

      int bsint = 0; //change to int
      for(int i = 0; i < k; i++) bsint |= bs[i] << i;

      //add to dp knapack fashion
      for(int i = 2; ~i; i--)
      for(int j = 0; j < (1 << k); j++){
        if(dp[i][j].size() == i && (i || !j)){
          int x = i + 1, y = j | bsint;
          if(dp[x][y].empty()){
            dp[x][y] = dp[i][j];
            dp[x][y].push_back(probe);
          }
        }
      }
		}
	}
  
  int retx = 0, rety = 0;
  //find best dp coverage
  for(int i = 3; i <= 3; i++)
  for(int j = 0; j < (1 << k); j++){
    if(!dp[i][j].empty() && __builtin_popcount(j) > __builtin_popcount(rety)){
      retx = i, rety = j;
    }
  }

  cout << retx << " " << rety << endl;
  for(string probe : dp[retx][rety]){
    bitset<k> bs = test(probe);
    for(int i = 0; i < k; i++) cout << bs[i];
    cout << endl;
    cout << probe << endl;
  } 
}

void mkscores() {
    cout << '{';
	for (int i = 0; i < 3; ++i) {
		cout << "{";
		for (int j = 0; j < 7; ++j) {
			score[i][j] = 0;
			for (int k = 0; k < 20; ++k)
				score[i][j] += sequenceCmp(P[i], vrt[j][k]);
			score[i][j] /= 20;
			cout << score[i][j];
			if (j < 6) cout << ",";
		}
		cout <<"}";
        if (i < 2) cout << ",";
        cout << '\n';
	}
	cout << '}';
}

// classify a string
int solve(string & s) {
	double val[3];
	for (int i = 0; i < 3; ++i) val[i] = sequenceCmp(P[i], s);
	double diff[7];
	for (int i = 0; i < 7; ++i) {
		diff[i] = 0;
		for (int j = 0; j < 3; ++j) diff[i] += pow(val[j]-score[j][i], 2);
	}
	return min_element(diff, diff+7)-diff;
}

string types[7] = {"original",
"B.1.1.7",
"B.1.351",
"B.1.427",
"P.1",
"not_sars_cov2",
"not_sars_cov2"
};

void answer(){
  for(int i = 0; i < 100;i++){
    string inp; cin >> inp;
    cout << types[solve(inp)] << '\n';
  }
}



int main(){
  ios::sync_with_stdio(0);
  cin.tie(0);
  srand(time(0));
  /*if (fopen("input.txt", "r")) {
    freopen("input.txt", "r", stdin);
    answer();
    return 0;
  }*/
  if (fopen("spikesequences.txt", "r")) {
      freopen("spikesequences.txt", "r", stdin);
	for (int i = 0; i < 7; ++i) { // 7 vrts
		for (int j = 0; j < 20; ++j) {
			string s, t; cin >> s >> t;
			vrt[i].push_back(t);
		}
	}
// 		if (P[0] != "") mkscores();
//         else
            analyze_spike_sequences();
		return 0;
  }
  
  answer();
  return 0;
}