a/COVID-Challenge
1
0
Fork 0
Code Issues Pull requests Projects Releases Wiki Activity

Add latest changes

Browse source
This commit is contained in:
Anthony Wang 2021-06-02 16:46:12 -05:00
parent 206bdf3d78
commit 5bbf11ad5a
Signed by: a
GPG key ID: BC96B00AEC5F2D76
1 changed files with 20 additions and 11 deletions
Show stats Download patch file Download diff file Expand all files Collapse all files

31
main.cpp
View file

@ -2,8 +2,13 @@
using namespace std;
using ll = long long;
string P[3];
double score[3][7];
string P[3] = {
"ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCA",
"CCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTC",
"TTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATC" };
double score[3][7] = { {449.7,449.7,449.7,449.7,437.7,161,147.35},
{449.7,449.7,449.4,449.7,437.7,158,149},
{449.7,449.4,404.4,450,449.7,172,146.85} };
vector<string> vrt[7];
@ -54,7 +59,7 @@ bitset<k> test(string & probe) {
for (int i = 0; i < 7; ++i)
for (int j = i+1; j < 7; ++j)
{
if (abs(avg[i]-avg[j]) > 10) bs[cnt] = 1;
if (abs(avg[i]-avg[j]) > 5) bs[cnt] = 1;
cnt++;
}
return bs;
@ -62,13 +67,6 @@ bitset<k> test(string & probe) {
vector<string> dp[4][1 << k];
void analyze_spike_sequences(){
freopen("spike_sequences.txt", "r", stdin);
for (int i = 0; i < 7; ++i) { // 7 vrts
for (int j = 0; j < 20; ++j) {
string s, t; cin >> s >> t;
vrt[i].push_back(t);
}
}
int cnt = 0;
for (int i = 0; i < 7; ++i) {
for (int j = 0; j <= vrt[i][0].size()-150; j += rand()%100) {
@ -112,6 +110,7 @@ void analyze_spike_sequences(){
}
void mkscores() {
cout << '{';
for (int i = 0; i < 3; ++i) {
cout << "{";
for (int j = 0; j < 7; ++j) {
@ -122,8 +121,11 @@ void mkscores() {
cout << score[i][j];
if (j < 6) cout << ",";
}
cout <<"}\n";
cout <<"}";
if (i < 2) cout << ",";
cout << '\n';
}
cout << '}';
}
// classify a string
@ -162,6 +164,13 @@ int main(){
ios::sync_with_stdio(0);
cin.tie(0);
if (fopen("spike_sequences.txt", "r")) {
freopen("spike_sequences.txt", "r", stdin);
for (int i = 0; i < 7; ++i) { // 7 vrts
for (int j = 0; j < 20; ++j) {
string s, t; cin >> s >> t;
vrt[i].push_back(t);
}
}
if (P[0] != "") mkscores();
else analyze_spike_sequences();
return 0;